Key Points
- CBSE released Class 12 Biology sample paper & marking scheme for 2025-26 academic year.
- Class 12 board exams start Feb 17, 2026, Biology exam on March 27, 2026.
- CBSE has released the Class 12 Admit Card 2026; essential for exam entry.
CBSE Class 12 Biology Sample Paper 2025-26: For the current academic year 2025–2026, the Central Board of Secondary Education has released the most recent sample paper. Along with the marking scheme, students can obtain the sample paper for free. For students, sample papers are crucial since they serve as practice exams. Students can gain knowledge about the question type and overall mark weighting by using sample papers. Furthermore, students' learning and exam preparation can be improved by using example papers. The CBSE Board has also relased the datesheet and admit card for the upcoming 2026 board exam. The CBSE Class 12 Board exams will start from 17th February 2026 and will end on 10th April 2026, Biology exam will take place on 27th March, 2026. Students are advised to practice the Sample Papers as it'll help them gaining confidence for the exam.
Preparing for board exams can be challenging, but with the right strategies you can approach your studies in the right direction. In this article, we have provided the complete Biology sample paper and their marking scheme released by the CBSE Board. Read the complete article for the latest update and get a free link to download Biology PDF.
CBSE Class 12 Biology Sample Paper 2025-26
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions.
(iii) 5 Sections
-
Section–A has 16 questions of 1 mark each;
-
Section–B has 5 questions of 2 marks each;
-
Section– C has 7 questions of 3 marks each;
-
Section– D has 2 case-based questions of 4 marks each; and
-
Section–E has 3 questions of 5 marks each.
(iv) There is no overall choice. Answer all 33 questions. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.
| Section – A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. | |||||||||||||||||||||||||||
| Q. No. | Questions | Marks | |||||||||||||||||||||||||
| 1. | The male gametes are formed by: A. Mitotic division of nucleus of vegetative cell B. Meiotic division of nucleus of vegetative cell C. Mitotic division of nucleus of generative cell D. Meiotic division of nucleus of generative cell | 1 | |||||||||||||||||||||||||
| 2. | The primary endosperm nucleus is formed by fusion of which of the following? A. A male gamete and a female gamete B. A male gamete and two polar nuclei C. A female gamete and two synergids D. Two male gametes and an egg cell | 1 | |||||||||||||||||||||||||
| 3. | During the menstrual cycle of a human female, formation of graafian follicle is stimulated by secretion of which of the following gonadotropin hormones? A. Estrogen and progesterone B. FSH and Estrogen C. FSH and LH D. Progesterone and LH | 1 | |||||||||||||||||||||||||
| 4. | The experimental proof on the thermal stability of genetic material was first provided by experiments of A. Hershey and Chase B. Meselson and Stahl C. Frederick Griffith D. Jacob and Monod | 1 | |||||||||||||||||||||||||
| 5. | Short stretches of DNA used to identify complementary sequences in a sample are called A. Probes B. Markers C. Primers D. Minisatellites | 1 | |||||||||||||||||||||||||
| 6. | Select the incorrect statement among the following. A. p 2+2pq+q2 = 1. This is binomial expansion of (p+q)2 . B. When frequency measured differs from expected values, the difference (direction) indicates the extent of evolutionary change. C. Hardy-Weinberg principle says that phenotype frequencies in a population are stable and are constant from generation to generation. D. The gene pool (total genes and their alleles in a population) remains constant. This is called genetic equilibrium. Sum total of all the allelic frequencies is 1 | 1 | |||||||||||||||||||||||||
| 7. | Albinism is known to be due to an autosomal recessive mutation. The first child of a couple with normal skin pigmentation was an albino. What is the probability that their second child will also be an albino? A. 100% B. 25% C. 50% D. 75% | 1 | |||||||||||||||||||||||||
| 8. | "In Cricket species, the sound produced by rubbing the wings or legs together play a crucial role in attracting mates, any change in the morphology of Cricket legs could potentially affect their ability to produce sound”. A mutant Cricket had thicker hind legs. What would you expect for this cricket species? A. The leg mutation will not lead to speciation if they diversify into new habitats. B. The leg mutation will have little effect on other external features, and therefore have little effect on speciation. C. The leg mutation will have no effect on behavior, and thus have little effect on speciation. D. The leg mutation might lead to reproductive isolation and speciation due to an effect on the mating call. | 1 | |||||||||||||||||||||||||
| 9. | The image contains a multiple-choice question about the life cycle of the Plasmodium parasite, which causes malaria. The question asks to identify the correct sequence of transmission. Question: Plasmodium is a pathogen that causes malaria. Identify the correct sequence of transmission of the pathogen. Table of Options:
| 1 | |||||||||||||||||||||||||
| 10. | Which mRNA will be translated to a polypeptide chain containing 8 amino acids? A. AUGUUAAUAGACGAGUAGCGACGAUGU B. AUGAGACGGACUGCAUUCCCAACCUGA C. AUGCCCAACCGUUAUUCAUGCUAG D. AUGUCGACAGUCUAAAACAGCGGG | 1 | |||||||||||||||||||||||||
To download the rest of the sample paper, we are providing the link below:
CBSE Class 12 Biology Marking Scheme 2025-26
Since students are now receiving a sample paper, we are also giving them the marking guidelines and the solutions. The marking scheme and answers are available for students to view after completing the example papers.
Students will first be able to view some images of the marking scheme before downloading the PDF for free.
CBSE Class 12 Date Sheet 2025-26
The CBSE Class 12th exam dates are out for the 2026 board examination. As per the date sheet, the CBSE Class 12 exams will start on Feb 17, 2026. Check the complete CBSE Class 12 Date Sheet 2026 for more information.
CBSE Class 12 Admit Card 2026: Released
The Central Board of Secondary Education (CBSE) has officially released the Class 12 Admit Card 2026 for students appearing in the senior secondary board examinations this year. The hall ticket is an essential document that every candidate must carry to the exam centre for verification and entry. It contains important details such as the student’s name, roll number, examination centre address, exam dates, reporting time, and subject codes.
| CHECK: CBSE Class 12 Admit Card |
Also Check:
-1770118889369.jpg)
Comments
All Comments (0)
Join the conversation